Is the Seeker Primary Analysis Pipeline compatible with MGI/BGI sequencers?

No, but the FASTQ files can be edited to work with the Seeker Primary Analysis Pipeline. The fastq.gz files generated by MGI/BGI sequencers are incompatible with the Seeker pipeline. They are in the following format (notice the designator for Read 1 and Read 2, highlighted in yellow ). Example R1.fastq.gz: @HWI-ST12345:1:1:1001:1000/1 ACGTACGTACGTACGTACGTACGTACGTACGT + [...]

How do I trim my FASTQ pairs to be at least 50 bp?

Some core facilities or commercial sequencing companies only run higher cycle kits (e.g., 2 x 150, 2 x 200). We only require 2 x 50. If you need to trim your reads, follow this procedure: Use the following commands to trim your reads using chopper: conda install -c bioconda chopper gunzip -c file_R1.fastq.gz | chopper --tailcrop 10 | gzip > file_cropped_R1.fastq.gz Here, --tailcrop 10 chops 10 [...]

How do I get untrimmed reads from the sequencer?

Some customers get trimmed reads automatically during demultiplexing from the sequencing core. During demultiplexing, there is an option to remove the common adapter sequence. If you turn this option off, the reads will be a constant length/untrimmed. [...]

What are the format requirements for the input FASTQ pairs?

For each sample, prepare a single Read 1 and a single Read 2 FASTQ file. All FASTQ inputs are compressed in .gz format. All reads in Read 1 FASTQ have the same length. All reads in Read 1 FASTQ are at least 50 bp. Read 1 and Read 2 FASTQ contain the same number of reads. [...]

In Read 2, are there any negatives to incorporating reads beyond the minimum 50 bp, besides needing more computing time (i.e., taking an 'as much as possible' approach)?

With the current aligner (STAR) and the library prep protocol used, there is an optimal range of Read 2 length to reach maximum alignment quality (between 50–150 bp). A Read 2 length of >150 bp will ultimately lead to lower alignment quality. [...]